Id Trinity | TRINITY_DN51510_c5_g1_i4 |
---|---|
Name Transcript | Ll_transcript_300291 |
Sequence | ATTAAGGAAGCTTTCGATGCCGCCTACAGCAATATATATGCATTTCATGCTGCTCAGAAGTCACCTGAGAGAAGCGTTGAGAATATGAAAGGGGAACGGC TGTATTACCTTCAACAGCTTTGATGCTTTCAGTTCCTGCACAAATTGCTGGATGTAAAACTATTGTTCTTGCAACTCCTCCATCTAAGGATGGCACTATA TGCAAGG BLAST |
Tissue | pods |
Gene name | LI_gene_185459; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_300291
Blastp | - |
---|---|
Blastx | Histidinol dehydrogenase, chloroplastic from Arabidopsis with 89.47% of identity |
Eggnog | Catalyzes the sequential NAD-dependent oxidations of L- histidinol to L-histidinaldehyde and then to L-histidine (By similarity)(COG0141) |
Kegg | Link to kegg annotations (AT5G63890) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019425544.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |