Id Trinity | TRINITY_DN51582_c0_g1_i5 |
---|---|
Name Transcript | Ll_transcript_300517 |
Sequence | TTGGATGTTCATTCAACTTTGGGCCAAATATGATGATTGAGAGTGGTGCTTTCAAGGGAATTATAAAGTTTGTGATGTTGTATATGTTGAATTTCCGGAA GTAGGAGCAACTGTAAGACAAGGAGAAGGCTTTGGCGCAGTTGAAAGTGTGAAGGCTAGTGATATTAACTCTCCTGTTTTTGGAAAAGTGGTTGAAGTTA ATGAAGAGCTTAGCAGTTCTCTTGCTCTGGTTGATGGAAAAGTTGGACATCA BLAST |
Tissue | pods |
Gene name | LI_gene_186046; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_300517
Blastp | - |
---|---|
Blastx | Glycine cleavage system H protein 2, mitochondrial from Arabidopsis with 74.55% of identity |
Eggnog | The glycine cleavage system catalyzes the degradation of glycine. The H protein shuttles the methylamine group of glycine from the P protein to the T protein (By similarity)(COG0509) |
Kegg | Link to kegg annotations (AT2G35120) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019420317.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |