Ll_transcript_300520

• Id Trinity: TRINITY_DN51582_c0_g1_i6
• Name Transcript: Ll_transcript_300520
• Sequence: GAAATATTTGAAGTATGCTGATTCTCATGAGTGGGTGAAGGTAGATGGAAATTCTGCAACTGTTGGCATAACTGACCATGCCCAATATCATCTAGGTGAT GTTGTATATGTTGAATTTCCGGAAGTAGGAGCAACTGTAAGACAAGGAGAAGGCTTTGGCGCAGTTGAAAGTGTGAAGGCTAGTGATATTAACTCTCCTG TTTTTGGAAAAGTGGTTGAAGTTAATGAAGAGCTTAGCAGTTCTCTTGCTCTGGTTGATGGAAAAGTTGGACATCA
• Tissue: pods
• Gene name: LI_gene_186046;
• Additional information: -

Expression of Ll_transcript_300520

FPKM

• PAB: 1.4
• PNAB: 3.1
• PS1: 5.2
• PS2: 2
• PS3: 8.1
• PW1: 0.4
• PW2: 1.6
• PW3: 5.4

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_300520

• Blastp: -
• Blastx: Glycine cleavage system H protein 2, mitochondrial from Arabidopsis with 78.16% of identity
• Eggnog: The glycine cleavage system catalyzes the degradation of glycine. The H protein shuttles the methylamine group of glycine from the P protein to the T protein (By similarity)(COG0509)
• Kegg: Link to kegg annotations (AT2G35120)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019420317.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;