Id Trinity | TRINITY_DN51604_c0_g1_i7 |
---|---|
Name Transcript | Ll_transcript_408168 |
Sequence | TATTCTTGTATCTTTTCGATTTGTATTGCGAACTTAATATTGTCTTTGTGTGTTACATGCTTGTTGAAATTTTACTCTGCAGAAAACAAAGCCAACTCAG CACAGTGTTCGACAACTTAGAGGATTAGGTTTGACCCCGAATCTTCTTGCTTGTCGCAGCACAAAGGAACTTGATGACAATGTTAAGGCAAAACTTGCTC AAT BLAST |
Tissue | pods |
Gene name | LI_gene_186265; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_408168
Blastp | - |
---|---|
Blastx | CTP synthase from Syntrophomonas with 61.54% of identity |
Eggnog | Catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen (By similarity)(COG0504) |
Kegg | Link to kegg annotations (Swol_2418) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019456677.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |