Id Trinity | TRINITY_DN51740_c1_g1_i1 |
---|---|
Name Transcript | Ll_transcript_296394 |
Sequence | GGAGCGACTTGATTGTAAGAAAGATAGTGAGATATGGGAGAAAGATGAGAATATATTGCAGCTACGTCATTGGGCCTCATTACGAGGACAAACTCTCTCC AGGACAGTTAGGGGAATGATGTACTACAGGCGGGCTCTTAAGCTCCAGGCTTTTCTTGATATGGCTAATGAGAAGGAGATACTTGATGGCTATAAAGCTA TTACTGTTCCATCTGAGGAAGAAAAAAAGAGTCACAGATCCCTGTATGCCAGTTTAGAGGCTATAGCTGACATGAAATTCACCTATGTCGCTACCTGTCA GAACTATGGAAAT BLAST |
Tissue | pods |
Gene name | LI_gene_187275; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_296394
Blastp | Callose synthase 5 from Arabidopsis with 79.81% of identity |
---|---|
Blastx | Callose synthase 5 from Arabidopsis with 79.81% of identity |
Eggnog | synthase(ENOG410XQ8V) |
Kegg | Link to kegg annotations (AT2G13680) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019437222.1) |
Pfam | 1,3-beta-glucan synthase component (PF02364.14) |
Rfam | snoJ33 (RF00315) |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |