Id Trinity | TRINITY_DN51864_c1_g1_i10 |
---|---|
Name Transcript | Ll_transcript_447361 |
Sequence | AGTTTAATAATTTTATTTGCTGTAATTTTTTCTATGGTTGATTCCCCTTTTTACTTGCTGTTACTAAGATATTTGCTACATATTTACAGCTGCCAGATCA TTGGATGTCTTGAATTTCACTCCTCTCAATAACAAGCCCATCCGCATCATGTATTCTCACCGAGATCCTAGTGTTCGTAAAAGTGGAGCAGGAAATATTT TTATCAAGAATâBLAST |
Tissue | pods |
Gene name | LI_gene_188138; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_447361
Blastp | - |
---|---|
Blastx | Polyadenylate-binding protein 2 from Arabidopsis with 75.61% of identity |
Eggnog | poly(A) binding protein, cytoplasmic(ENOG410XR5X) |
Kegg | Link to kegg annotations (AT4G34110) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019421446.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |