Id Trinity | TRINITY_DN51922_c2_g1_i1 |
---|---|
Name Transcript | Ll_transcript_399826 |
Sequence | TCCTATCCAGAGGATGATAGTGTCTTGGACCCACTTTTAGCACAACATTTGGCATTTTTTGGCATCGACTTCTCATCACTTCAAAAGACTGAAATGACGA CTGCTGAAAGGGAACTTGATCAAAATACCAACTTTGATTGGAATCGAATCCAAGAAAGTGGACAGGAAGTGGAACCGATTTTTGGACCTGGATATACCGG ATTAGTCAATCTTGGAAACAGTTGTTACTTGGCAGCAACTATGCAAGTTGTGTTTTCAACAGGATCTTTCTCTTCAAGGTACTATATAAACCAAAATTTA AAGAAGGCGTTTGAGGCTGCTCCTGCTGATCCAACTGTGGACCTAAATATGCAGTTGACAAAGCTGGCTCATGGTCTTCTGTCTGGTAAATATTCTACTC CAGCTTCTCAGAAT BLAST |
Tissue | pods |
Gene name | LI_gene_188611; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_399826
Blastp | Ubiquitin carboxyl-terminal hydrolase 14 from Arabidopsis with 84.78% of identity |
---|---|
Blastx | Ubiquitin carboxyl-terminal hydrolase 14 from Arabidopsis with 84.78% of identity |
Eggnog | ubiquitin carboxyl-terminal hydrolase(COG5207) |
Kegg | Link to kegg annotations (AT3G20630) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019442658.1) |
Pfam | Ubiquitin carboxyl-terminal hydrolase (PF00443.28) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |