Id Trinity | TRINITY_DN51946_c1_g1_i1 |
---|---|
Name Transcript | Ll_transcript_398552 |
Sequence | GTGGTCTCTAACCGCTTTGTCTAGTGCCCAATGCCAGGTTGCATCTATGGTACTTATATCTTGGTTCAAGGAGATAAAGAGCATTTATTCATCCAAAAAC CTCAATGGTATTTATTCCTGGTGCCCTCAAAGATTGGTTGCTGCACTTATTAGGATGTACTGACCCTGCATTCCCAACAAAAGATTTGTTTGTCTTCATT AGACATATACATCGAGAATAGCTGTTAATCCCTTCACAAACCTACCTCATTTGTATGATACCCATATGATGGAACAATATAAGGGAGCAACATAGGTACT AATTCCTCATGTTTTTC BLAST |
Tissue | pods |
Gene name | LI_gene_188793; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_398552
Blastp | - |
---|---|
Blastx | TATA-binding protein-associated factor BTAF1 from Arabidopsis with 61.29% of identity |
Eggnog | excision repair cross-complementing rodent repair deficiency complementation group(ENOG410XP4Z) |
Kegg | Link to kegg annotations (AT3G54280) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019412827.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |