Ll_transcript_399264

• Id Trinity: TRINITY_DN51980_c0_g1_i4
• Name Transcript: Ll_transcript_399264
• Sequence: GTCAAGGTGAGCTGTTGTTTTTCCTCTAATTGTTTCTTAGCGATTACATTGCATGCTTTGTTGGGGGATTAGATATGTTGGCTTAAAGCCGTTCCTTCGT TGAAGATTTCCTTTGCTTTGCTTTTATAGGTGGCTGATCCTGTTGTTTCGTTTTGTGAAACTGTTGTCGAGTCTTCATCAATGAAATGTTTTGCTGAGAC ACCAAACAAGAAGAATAAAATAACCATGATTGCTGAGCCACTAGAAAGAGGTCTTGC
• Tissue: pods
• Gene name: LI_gene_189078;
• Additional information: -

Expression of Ll_transcript_399264

FPKM

• PAB: 0
• PNAB: 0.4
• PS1: 0.3
• PS2: 0
• PS3: 0
• PW1: 0
• PW2: 0
• PW3: 0

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_399264

• Blastp: -
• Blastx: 110 kDa U5 small nuclear ribonucleoprotein component CLO from Arabidopsis with 97.62% of identity
• Eggnog: Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post- translocational (POST) state as the newly formed A-site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome (By similarity)(COG0480)
• Kegg: Link to kegg annotations (AT1G06220)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_004508402.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;