Id Trinity | TRINITY_DN52086_c0_g1_i13 |
---|---|
Name Transcript | Ll_transcript_473081 |
Sequence | GCAATCCTACGCATTCACTTTTTGATAGATATAATGATTCATATCTAAGGCGAATTGGAAGTACAATTTTGTCTTATGTCAATATGGTCTGTGCAACTCT GCGGCATTCTATTCCGAAGTCCATCGTCTATTGTCAAGTGCGGGAGGCAAAACGAGCCCTACTTGATCACTTTTTCACTGATCTAGGCAAAATGGATCCA AAGCGGTTATCAGCATTGCTGAATGAGGATCCTGAAGTTATGGAACGTCGTAGTGCCCTCGCAAAGAGACTTGAATTATACCGGAGTGCACAAGATGAAA TAGATGCAGTTGCTTG BLAST |
Tissue | pods |
Gene name | LI_gene_189929; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_473081
Blastp | Dynamin-related protein 5A from Soja with 89.42% of identity |
---|---|
Blastx | Dynamin-related protein 5A from Soja with 89.42% of identity |
Eggnog | Dynamin family(COG0699) |
Kegg | Link to kegg annotations (100037461) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019421954.1) |
Pfam | Dynamin GTPase effector domain (PF02212.17) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |