Ll_transcript_429167

• Id Trinity: TRINITY_DN52161_c0_g1_i2
• Name Transcript: Ll_transcript_429167
• Sequence: CTCTTAGGCATGGTTAAAATACTTGTTGGACTACCCCTCTCATTGCCAATTAGTTTTGAGATGATACCTTGACAGTGTCAACTAAAATGCATATGATAGT TTTCAGAGACTTTTGGGTGAACTAAAGGTTTCAATTTTCTGAATACTACTAACTAGTCTTCATATGCTAATTTTAAGCTTTTATGAATATCATGTTTTGT AATCTTTAATTTCCAAATCCAGTGATGAGAATTTTGATGTTACTCGAGCACAAATGATTCTTGATGAAGACCATTATGGATTAACGGATGTGAAGGATAG GATATTGGAATTCATAGCTGTTGGGAAATTAAG
• Tissue: pods
• Gene name: LI_gene_190544;
• Additional information: -

Expression of Ll_transcript_429167

FPKM

• PAB: 0
• PNAB: 0
• PS1: 1
• PS2: 1.1
• PS3: 1.1
• PW1: 0
• PW2: 1.5
• PW3: 0.7

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_429167

• Blastp: -
• Blastx: Lon protease homolog 1, mitochondrial from Arabidopsis with 55.07% of identity
• Eggnog: ATP-dependent serine protease that mediates the selective degradation of mutant and abnormal proteins as well as certain short-lived regulatory proteins. Required for cellular homeostasis and for survival from DNA damage and developmental changes induced by stress. Degrades polypeptides processively to yield small peptide fragments that are 5 to 10 amino acids long. Binds to DNA in a double-stranded, site-specific manner (By similarity)(COG0466)
• Kegg: Link to kegg annotations (AT5G26860)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019452267.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;