Id Trinity | TRINITY_DN52325_c0_g1_i24 |
---|---|
Name Transcript | Ll_transcript_485263 |
Sequence | GGCCCAAATATTGTCAAGCTTCTTGATATTGTCAGAGATCAACATTCAAAAACTCCGAGCTTGATATTTGAGTATGTCAATAGTACAGATTTTAAAGTTC TATATCCAACCTTGACTGATTATGACATACGCTATTACATTTATGAGCTCCTGAAGGCCTTGGATTTCTGCCACTCTCAAGGCATAATGCATAGAGATGT CAAGCCCCACAACGTTATGATAGATCACGAGTTACGAAAACTTCGCTTGATAGATTGGGGCCTTGCTGAATTTTATCATCCTGGAAAGGAATATAATGTT CGTGTAGCTTCAAGATA BLAST |
Tissue | pods |
Gene name | LI_gene_191777; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_485263
Blastp | Casein kinase II subunit alpha-1 from Arabidopsis with 99.05% of identity |
---|---|
Blastx | Casein kinase II subunit alpha-1 from Arabidopsis with 99.05% of identity |
Eggnog | Casein Kinase(ENOG410XNPP) |
Kegg | Link to kegg annotations (AT5G67380) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020978591.1) |
Pfam | Protein kinase domain (PF00069.24) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |