Id Trinity | TRINITY_DN52415_c0_g5_i1 |
---|---|
Name Transcript | Ll_transcript_348975 |
Sequence | ATATAATCATAGGCTTTGGTCAAAGCCCCATGAGAAGCATAAACAGTCCTGCTGAAGTTCATTCCCATTAACTTCATTGTAGAAAACACGATACAACCCA GCACGCTAATATATGTTACTTTTCCAAATATGTGTGCATGAGTGAAGTGGCTACCCCAGATCCCATTGTGCTGAGTGTTAAGGCTCCTTTTCACTTGAAC AGGAGAATCACTCAGATTGTTAGCTTCTTCATTTCTGCCAGATAGCAGAGAACTCTGCAAATCAGTAGGAGCCAGCTGCTTGACAGCAAACCCTATATTT GGAGAAGAGCTCATATAAGAGCGAGGTTCCTCGGTCTCTCTTCGGTCTAAGGAA BLAST |
Tissue | pods |
Gene name | LI_gene_192533; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_348975
Blastp | Plastid division protein CDP1, chloroplastic from Arabidopsis with 37.78% of identity |
---|---|
Blastx | Plastid division protein CDP1, chloroplastic from Arabidopsis with 37.78% of identity |
Eggnog | plastid division protein CDP1, chloroplastic-like(ENOG410YAIP) |
Kegg | Link to kegg annotations (AT3G19180) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019457878.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |