Ll_transcript_348608

• Id Trinity: TRINITY_DN52460_c2_g2_i2
• Name Transcript: Ll_transcript_348608
• Sequence: ACATACAGAGTTTCCATCAAATTTTAATGACTCAAATATGCCAGACGACAAGATTCATCTATTGGGTTTGGAGCACCAGTCCGTGCCAATATGAGAACTG GTGGAGTTACAAATGCATCAGTAACATCAACTTTACTTGAATCGGTTGAAAGTTCTGATCTTATTGCATATGGTCTCATACCTGAGTTTATTGGACGGTT TCCAATCTTAATTAGCTTGTCAGCTTTAACTGAAGACCAACTTATGCAGGTCCTCACGGAACCAAAACA
• Tissue: pods
• Gene name: LI_gene_192899;
• Additional information: -

Expression of Ll_transcript_348608

FPKM

• PAB: 0
• PNAB: 0
• PS1: 0.2
• PS2: 0
• PS3: 1
• PW1: 0.4
• PW2: 3.1
• PW3: 0

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_348608

• Blastp: -
• Blastx: CLP protease regulatory subunit CLPX1, mitochondrial from Arabidopsis with 85.33% of identity
• Eggnog: ATP-dependent specificity component of the Clp protease. It directs the protease to specific substrates. Can perform chaperone functions in the absence of ClpP (By similarity)(COG1219)
• Kegg: Link to kegg annotations (AT5G53350)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019429054.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;