Id Trinity | TRINITY_DN52544_c1_g4_i6 |
---|---|
Name Transcript | Ll_transcript_507459 |
Sequence | CGAGAGAATGAGCAGCTATCCAAGTATGGTGACACCAAAACCGCACGAGGTATCATGTTGATAGAGCTAAAAAAGCTCATCGATGCAAATCCTCTCTTCC GTGATAAGCTTGTCTTCCCCAGTCTCAAGTCCTCAAGATTGAGGACTTTAATCAATCAAAGTTTGAACTGGCAGCACCAGCTTTGTAAAAACCCAAGGCC AAACCCGGATATAAAGACCTTATTCACAGATCACTCGTGTGCACCTCCTAATGGTCCTCTAGCACCTACACCAGTGAATCTTCCTGTTGCTGCAGTTGCA AAGCCTGCTACATATACTTCACTTGGAGC BLAST |
Tissue | pods |
Gene name | LI_gene_193597; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_507459
Blastp | Topless-related protein 3 from Arabidopsis with 84.4% of identity |
---|---|
Blastx | Topless-related protein 3 from Arabidopsis with 84.4% of identity |
Eggnog | Positively regulates the activity of the minus-end directed microtubule motor protein dynein. May enhance dynein- mediated microtubule sliding by targeting dynein to the microtubule plus end. Required for(ENOG410XP3K) |
Kegg | Link to kegg annotations (AT5G27030) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019440603.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |