Ll_transcript_504896

• Id Trinity: TRINITY_DN52560_c2_g1_i5
• Name Transcript: Ll_transcript_504896
• Sequence: ATTTATGACATCTTTGTGCATGTTATCTTTATACTATAGTCAATCATTTCTTGATTTACCTGTCCAGGTCTGTGAGCAATGCCCTAATGTCAAATATGTA AGGGAGGGGTATTTCATCACTGTTGATATTGAGAAAGGAATGCAAGATGGACAGGAGGTGCTATTTTATGAGGACGGCGAGCCCAAAATTGATGGAGAGT CTGGAGATTTAAGGTTTCGTATCCGTACTGCACCGCATGATCTCTTCAGACGGGAAGGCAATGACTTGCACACC
• Tissue: pods
• Gene name: LI_gene_193713;
• Additional information: -

Expression of Ll_transcript_504896

FPKM

• PAB: 0
• PNAB: 0
• PS1: 0
• PS2: 0
• PS3: 0
• PW1: 0
• PW2: 0
• PW3: 0

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_504896

• Blastp: -
• Blastx: DnaJ protein ERDJ3B from Oryza sativa with 68.89% of identity
• Eggnog: ATP binding to DnaK triggers the release of the substrate protein, thus completing the reaction cycle. Several rounds of ATP-dependent interactions between DnaJ, DnaK and GrpE are required for fully efficient folding. Also involved, together with DnaK and GrpE, in the DNA replication of plasmids through activation of initiation proteins (By similarity)(COG0484)
• Kegg: Link to kegg annotations (4337860)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_016205763.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;