Id Trinity | TRINITY_DN52570_c0_g1_i11 |
---|---|
Name Transcript | Ll_transcript_506005 |
Sequence | TAAGAACAATGGCATCCCATATTGTTGGATACCCACGTGTGGGCCCCAAGAGGGAGCTGAAGTTCGCTTTGGAGTCCTTCTGGGATGGAAAGAGCAGCGC TGAGGATTTGAAGAAGGTATCCGCCGAACTCAGGGCATCCATCTGGAAGCAGCAGGCTGGCGCTGGGATCAAGTACATCCCCAGCAACACTTTCTCATAC TATGATCACGTGCTCGATGCCACCGCCACCCTCGGCGCTGTCCCACCTAGATATGGCTGGCCTGGCGGTGAGCTTGGGTTCGCTACCTACTCCCCCCTGG BLAST |
Tissue | pods |
Gene name | LI_gene_193777; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_506005
Blastp | 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase from Cryophytum with 85.11% of identity |
---|---|
Blastx | 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase from Cryophytum with 85.11% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019442939.1) |
Pfam | Cobalamin-independent synthase, N-terminal domain (PF08267.11) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |