Id Trinity | TRINITY_DN52570_c0_g1_i3 |
---|---|
Name Transcript | Ll_transcript_505996 |
Sequence | CCAATGAAGGGAATGCTTACTGGCCCTGTCACCATCCTCAATTGGTCTTTCGTCAGAAACGATCAGCCTAGGTATAAACTCAAGACCCTTTACAATGTGG TGGGAAAAGAACAAGCAAACATTTAAAGTATAACCATATAGGAAAAACTATCATTATTCACCACACTGTTATGTCTAACATTTATGAATCTATTTTCAGA TCTGAGACCTGCTACCAG BLAST |
Tissue | pods |
Gene name | LI_gene_193777; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_505996
Blastp | - |
---|---|
Blastx | 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 2 from Oryza sativa with 78.79% of identity |
Eggnog | Catalyzes the transfer of a methyl group from 5- methyltetrahydrofolate to homocysteine resulting in methionine formation (By similarity)(COG0620) |
Kegg | Link to kegg annotations (4352833) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003624679.2) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |