Id Trinity | TRINITY_DN52689_c1_g1_i6 |
---|---|
Name Transcript | Ll_transcript_462708 |
Sequence | AATTCCGTTCTGGCTCTGTTCCTTTAGGGTTTTATGCATTGCAGAGGGATAACATATTTCCTGAGAGACCTGGTCAGCCTGAATGCCAATTCTACATGAA GACTGGAGATTGCAAGTTTGGTGCAGTTTGTCGGTTCCACCATCCGCGTGAGAGGCTGATTCCTGTTCCTGACTGTGTCTTGAGTCCAATAGGCCTTCCA TTGCGTCCTG BLAST |
Tissue | pods |
Gene name | LI_gene_194753; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_462708
Blastp | - |
---|---|
Blastx | Zinc finger CCCH domain-containing protein ZFN-like from Pisum with 92.75% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019427979.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |