| Id Trinity | TRINITY_DN52812_c4_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_493189 |
| Sequence | TCCGTTCAGATATATAATGTCCGTGTGGATGAGGTATCATTGCTGTCCATAAACAGCTTCTGCGTGTGCTTAGAGTAATTTGGTGTTTATGCGGAGTTTT TTCTTTGCAGGTTAAAAGTAAACTGAAAGGCCATACTAAAAGAATAACTGGTCTCGCTTTCTCTCATGTGTTGAACGTGCTAGTTTCGTCTGGGGCAGAT GCTCAGCTTTG BLAST |
| Tissue | pods |
| Gene name | LI_gene_195861; |
| Additional information | - |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_493189
| Blastp | - |
|---|---|
| Blastx | Protein TOPLESS from Arabidopsis with 91.18% of identity |
| Eggnog | Positively regulates the activity of the minus-end directed microtubule motor protein dynein. May enhance dynein- mediated microtubule sliding by targeting dynein to the microtubule plus end. Required for(ENOG410XP3K) |
| Kegg | Link to kegg annotations (AT1G15750) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_020227012.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |