Id Trinity | TRINITY_DN52813_c7_g1_i1 |
---|---|
Name Transcript | Ll_transcript_494561 |
Sequence | CTTATTCAAACAGTAAAGTATTTTTCGGTAGGAACTATTTGTGAAGCTTCTTCATTTTATAATTTAGCTCTAAAACGCCACCTTGGTGTTACATCAAGTT TGGGAGCAACGGGTAAGGTGATGGTAGTGTGGAGAGCGGTGAAAACTATTAAGAGCAGAGACACCAAAACAGAGAGGGTTGATAACACCAACATAATAGC ATGAGCCATGAGTCCCTCAACTTCTAGTGCATACTCTGATGAAGCCAATGCCAAAGCTGTCAGAGGAAAAGAATAAGCCCACCATGCCACACTGAACTTC TTCATCGACTTCTTAAATAGCAAAGGCCTTGATACGAGGGACATGAATAGAAAGAGGGAGAGGAAGAACAACATCTTTGAAGCAGTATCAAACTTGCCA BLAST |
Tissue | pods |
Gene name | LI_gene_195885; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_494561
Blastp | S-type anion channel SLAH1 from Arabidopsis with 58.42% of identity |
---|---|
Blastx | S-type anion channel SLAH1 from Arabidopsis with 80% of identity |
Eggnog | S-type anion channel SLAH1-like(ENOG410YDIV) |
Kegg | Link to kegg annotations (AT1G62280) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019450410.1) |
Pfam | Voltage-dependent anion channel (PF03595.16) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |