Id Trinity | TRINITY_DN52828_c3_g1_i9 |
---|---|
Name Transcript | Ll_transcript_492523 |
Sequence | ATCAAGGAGGAGGTAGAGACGTGACAGTCGAAGTCATTGATCGGGGACAATCGCAGGGTTTTGGTTTAACATTGGTAGAGACGATGATTTTCGGTTGTGA TGAAGCTACGAGTGCCCTCGACAGCACAACAGAAGCAGAGATTTTAAGTGCATCTAAGTCACTCGCAAATAATCGAACTTCCATATTCATTGCTCACAGG CTTACCACCGCAATGCAGTGTGATGAGATCATAGCTTTAGAGAATGGAAAGGGGACTGAGCAAGGACCCCATGAAGTGCTCATATCAAATGGAGGAAGAT ATGCACAACTTTAGGGACAGCGAAATAACACATATGATGC BLAST |
Tissue | pods |
Gene name | LI_gene_196036; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_492523
Blastp | ABC transporter B family member 25, mitochondrial from Arabidopsis with 78.67% of identity |
---|---|
Blastx | ABC transporter B family member 25, mitochondrial from Arabidopsis with 73.81% of identity |
Eggnog | iron ion homeostasis(COG5265) |
Kegg | Link to kegg annotations (AT5G58270) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020238628.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |