Id Trinity | TRINITY_DN56186_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_478621 |
Sequence | GTGCCAACAAATTAGATGAATCCCTTGTAGCTCGAATAAGGGCATCGCGAGGGGCAGGACCTTTGAGGTTACGGAGAGAGAAGAGAGCTCTGAATCGCTC ACAAATTGGTTGCTTCGTATCCACCAACAATTCGCACAGCATTTTTTCCATATCAATTGAACTCACCACGTCGTTTATGGAACCCGTCACCATACTCTAC TGCTCTTTCACCCTCGCACCAACCTGCTGCCTCACTATGTATCTTTCATTAGGGTATTGCATTATGGATTTATTATTCCTCAACAATTATGTTTATATTT ATTATTATTATATATAACTTTTTGTTGTATTTTAAAAATTAAT BLAST |
Tissue | pods |
Gene name | LI_gene_200033; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_478621
Blastp | - |
---|---|
Blastx | Deoxyhypusine hydroxylase from Arabidopsis with 71.67% of identity |
Eggnog | Catalyzes the hydroxylation of the N(6)-(4-aminobutyl)- L-lysine intermediate to form hypusine, an essential post- translational modification only found in mature eIF-5A factor (By similarity)(COG1413) |
Kegg | Link to kegg annotations (AT3G58180) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019426176.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |