Id Trinity | TRINITY_DN59927_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_522980 |
Sequence | GCCTCTTGCAGCAAAAACACTTGGAGGTTTGTTGCGCTTTAAAAGAGAGGAGAAGGAATGGCTCTATGTCAAGGAAAGCAAGCTATGTAATCTAACACAA GATGAGAACTCTGTCATGCCTGCCTTGAGATTAAGCTACTTGAACTTACCTATACAATTGAGACAATGTTTTGCCTTCTGTGCAATATTTCCCAAAGGTA AAAAAATTCGGAAGCATTTTCTGATCAAACTTTGGGTAGCTAATGGATTCATTTCATCCAACCAAATGTTGGAAGCTGAGGATGTTGGTGATGAGGTGGT GAATGAATTATACTGGAG BLAST |
Tissue | pods |
Gene name | LI_gene_203759; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_522980
Blastp | Putative disease resistance protein RGA3 from Solanum with 67.31% of identity |
---|---|
Blastx | Putative disease resistance protein RGA3 from Solanum with 67.31% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019445587.1) |
Pfam | NB-ARC domain (PF00931.21) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |