Id Trinity | TRINITY_DN67189_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_470296 |
Sequence | GTGCTGTTCTCACCACCCTGAAGGTCTCGAAGTGCGATCTCAATGATCCGGTCCTTCTCCCTGCTAAACCCGGTGGTCTCGATGTCAAAAACAATAACGG TGACTAAGCTAGATAAATCTTTATTCTGGGCAATCTCTTGTTGTATGACACAGTCCTGAATTGCCTGTGATTGATCTATCGGTGCTTTATGTACATTTAC AGTAGCACTTGTTAAAATTGTTTCACTCAAAATTTCATTCTTGGTACTTCTTGATTTGGTTCTCCCAGTGCCTTCGGTATTTGTAGTTATCGGTCTTCTA GTCCACTTCTTTCTTT BLAST |
Tissue | pods |
Gene name | LI_gene_211078; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_470296
Blastp | Exonuclease DPD1, chloroplastic/mitochondrial from Arabidopsis with 40.95% of identity |
---|---|
Blastx | Exonuclease DPD1, chloroplastic/mitochondrial from Arabidopsis with 40.95% of identity |
Eggnog | three prime repair exonuclease(ENOG4111YSP) |
Kegg | Link to kegg annotations (AT5G26940) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019419638.1) |
Pfam | Exonuclease (PF00929.23) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |