Id Trinity | TRINITY_DN67212_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_523174 |
Sequence | TTTCACAAGATGGTACTCCCTCAAGTGCTTGTCAGTGCCCGCCAAGTTCCTGCTCTTCTGAGGAGGAACTTCGGAATCTGCGTACCTGCAGCCCAGAAGG CATCTGATCCAATCCAACAGTTGTTCGTTGACAAAATTAGAGAATACAAGTCCAAAAGCTCTGGTGGTAAAATGGTTGAGGCCACTCCAGAAATCCAGAA AGAGTTGGCAGCTGAATTGGAACGAGTTCAGAAGACGTATGGATTTGCAGCAGGAGCCAATGTGTCAGACCTGCCCCCCATGAAATTCCAAGACCCTGAC CTGAGGGATGCTGTTTAGATGCCTTTTTCAACTTACGAACATTGGAATATTTGGAAATTGTTCTGTTATGTGACTAATTCGATTGTTGTGACATTGTCTC CCGTCACAATGTTCTTTGTTGAGGCACCTTGTAGACTACCATCATTGTAAATAAACTTAAA BLAST |
Tissue | pods |
Gene name | LI_gene_211102; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_523174
Blastp | ATP synthase-coupling factor 6, mitochondrial from Sophophora with 50.51% of identity |
---|---|
Blastx | ATP synthase-coupling factor 6, mitochondrial from Sophophora with 50.51% of identity |
Eggnog | Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain(ENOG41122G1) |
Kegg | Link to kegg annotations (Dmel_CG4412) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019459620.1) |
Pfam | Mitochondrial ATP synthase coupling factor 6 (PF05511.10) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |