Id Trinity | TRINITY_DN71424_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_333457 |
Sequence | TCCAGGTATTTCTCTGCCCCTATCCACAATTCCATCAGCTAATTTGCAGGCTTCCTTCACCCGCCCGGCTTTACACAGCACATGAATCATGTCTTCATAC GCAGTTTCCATAAGGATACCCATGGGAGCTAGCTCATCTAAAATCTTGCAAGCTCTCGCTACCTTACCAGAGAGACAAAGTCCAATTGAAAGAGCTCTAA AAGAGGCAACATTTGGTGTGATGCCCTTGTCAATCATCATGTCCCACAGTTTCAGTGCCTCTTCATTCCTGTGCTCCTTGAAAAGCTCGCTGATCAGTAT TGTATAAGTATAAACCGTCTGCTCAC BLAST |
Tissue | pods |
Gene name | LI_gene_215305; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_333457
Blastp | Pentatricopeptide repeat-containing protein At1g03560, mitochondrial from Arabidopsis with 81.48% of identity |
---|---|
Blastx | Pentatricopeptide repeat-containing protein At1g03560, mitochondrial from Arabidopsis with 81.48% of identity |
Eggnog | Pentatricopeptide repeat-containing protein(ENOG410Z7Z7) |
Kegg | Link to kegg annotations (AT1G03560) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019449225.1) |
Pfam | PPR repeat (PF12854.6) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |