Id Trinity | TRINITY_DN9331_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_481968 |
Sequence | AACGAGGTGTCGCTCCCAAGTCTCAAAAAGGGAACAAAATCGTTAAAAAGGCGACCGTCCAGAAAGCCCTCAAGGTCAAACAGAAGGTGATCAAAGGGTC GCACGGTACGCGTACGAGGAAGATCAGGACGTCAGTCCATTTCAGACGGCCGAAAACGTTCGAACCTCCCCGTAAACCGAAATACCCTCGTAAATCGGTC CCGACAAGGAACCGCATGGACGCTTACAACATCATCAAATCTCCTTTGACGACTGAAGCAGCCATGAAGAAAATTGAAGACAACAACACTTTAGTTTTCC BLAST |
Tissue | pods |
Gene name | LI_gene_223946; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_481968
Blastp | - |
---|---|
Blastx | 60S ribosomal protein L23a 2 from Caenorhabditis with 55.56% of identity |
Eggnog | One of the early assembly proteins it binds 23S rRNA. One of the proteins that surrounds the polypeptide exit tunnel on the outside of the ribosome. Forms the main docking site for trigger factor binding to the ribosome (By similarity)(COG0089) |
Kegg | Link to kegg annotations (CELE_F52B5.6) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (NP_001242083.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |