Id Trinity | TRINITY_DN24357_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_340514 |
Sequence | CAGGGAACCGCTCAGCCCGGCGACTTGCCGCCCGGCAGTAGCGACGAGGAGTCCGACGACGACGACGCTGCCGCCATGCCTTCCAACCCCAACCACACTG CTTCCGCGCGCAAGATGGCGGACGCCGCAAAGGACCCGGCCAAGGCAAAGGAGCCCGCCAAGGTCAAGAAGACCACCGACCCGTCGCAGCTGTCGCGCCG CGAGCGCGAGGCTCTCCAGGCCCAGCAGGCCAAGGAGCGCTATCAGAAGATGCACGCCGAGGGCAAGACGGACGAGGCGAGGGCCGATCTGGAGCGTCTG AAGCTTGTGCGCGAGCAGCGCAAGGAGGCCGCCGCGCGTAAAGAGGCCGAGA BLAST |
Tissue | pods |
Gene name | LI_gene_123682; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_340514
Blastp | 28 kDa heat- and acid-stable phosphoprotein from Rattus with 60.87% of identity |
---|---|
Blastx | 28 kDa heat- and acid-stable phosphoprotein from Rattus with 60.47% of identity |
Eggnog | PDGFA associated protein 1(ENOG4111T3A) |
Kegg | Link to kegg annotations (64527) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_015956399.1) |
Pfam | Casein kinase substrate phosphoprotein PP28 (PF10252.8) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |